As part of the Lulu Island Bog Inventory a small mammal survey was conducted. This survey targeted two species that may be federally listed in the future under Canada’s species at risk act, the Red-backed Vole and Snowshoe hare, and one that currently is listed, the Pacific Water Shrew. During live-trapping, some voles caught were identifiable as Townsend’s Vole and not our targeted Red-backed Vole. However, several voles were caught of uncertain identity as their morphological features overlapped between Townsend’s Vole (Microtus townsendii) and the western Red-backed Vole (Clethrionomys gapperi spp. occidentalis). This ambiguity was important to resolve as identification of the animals was considered an important component of the inventory.
To undertake an inventory of any species at risk one must deal with intrinsic legal issues under Canada’s Species at Risk Act (SARA). Legal issues revolve around the need to take vouchers in the form of skins and skulls. Vouchers are necessary as many small mammals can only be reliably identified by characteristics of the skull and teeth. Killing a member of a species that may be endangered in order to identify it has legal ramifications and requires special permits and expertise. Under SARA, harming a listed species is not permitted. Due to the potential presence of a federally listed species, the Pacific Water Shrew, our trapping permits for our inventory work did not permit killing of animals, and required that all animals be released. This meant that identification of ambiguous animals had to be dealt with in other ways. Fecal pellet analysis was identified as a potential solution to the challenge of identification. As explained below, one can obtain DNA from fecal pellets and use molecular biology to identify the animal that produced it to species. This eliminated our need to take voucher specimens and resolved any issues regarding identification based on skull characteristics or on cryptic or overlapping morphological characteristics.
Background
DNA barcoding is a somewhat controversial means of placing an unknown organism into a species. It is controversial because it appears to take emphasis and funding away from organismal biology and because some have claimed that the procedure can be applied to all branches of the tree of life. DNA is a molecule that holds all of the information to build living things. DNA molecules are made up of very long chains of four different molecules called nucleic acids. Molecular biologists are able to determine the identity and order of these nucleic acids along a DNA molecule. This is called a DNA sequence. In animal cells, DNA is found in two structures. Most DNA is found in the nucleus and is inherited from both maternal and paternal parents. However, there is also DNA contained within the mitochondria and these organelles are inherited from the mother only. Each cell has many mitochondria and each mitochondria has its own piece of circular DNA called mtDNA. Mitochondria are the engines of a cell that convert food energy into usable energy. DNA contains regions that code for the building blocks of life. These regions are called genes. Genes are generally stable parts of a DNA molecule because any changes in the nucleic acid sequence of the gene will often result in building blocks that do not work properly. When the building blocks do not work properly the animal will most likely die before it can pass on its genes or it will not be very successful at passing on its genes. As a result, there is not much sequence variation in a gene within a species. DNA barcoding argues that all members of a species will share a similar DNA sequence for a given gene and will have a dissimilar DNA sequence when compared to other species. This means that all one has to do in order to place an animal into a species is to get the sequence for a gene and determine to which species it is most similar. For a review of this technique see Hebert et al, 2004.
Using mtDNA has its advantages and disadvantages. The main advantages of using mtDNA are that it is abundant and it lacks many confounding phenomena associated with nuclear DNA. mtDNA it inherited only from the mother so it gives a clear picture of evolutionary history above the level of species. However, below the level of species, at the population level, the web-like relationships between individuals is invisible when using mtDNA. When working below the level of species one must work with the biparentally inherited nuclear genomes to get the full picture. To this end researchers usually use nuclear DNA markers such as microsatellites or AFLP’s. These techniques were too expensive to be used in this study and were unnecessary. They would have been necessary if there was potential for gene flow between Townsend’s Vole and Red-backed Vole. Gene flow between species is called lateral gene flow and the spread of a genome from one species into a different species is called introgression. Plants are much better at this than animals so botanists are used to dealing with these phenomena, but it is relatively rare in animals. Given that these two taxa are in different genera and the genetic distance between them is great, the probability of lateral gene flowand subsequent introgression occurring between them is highly unlikely. In this case DNA barcoding using mtDNA was appropriate.
Methods
Collection
Fecal pellets were collected from an ambiguous animal (hereafter referred to as the Lulu Island Bog [LIB] animal) and deposited into cryo-tubes. Within 2 hours of collection, the cryo-tubes were put into a -80oC freezer. Pellets were shipped in the cryo-tubes packed on dry ice to Adrian Kovack, Assistant Professor in the Department of Natural Resources at the University of New Hampshire. She extracted DNA from the pellets using a Qiagen- QIAamp DNA Stool Mini Kit (catalog # 51504), and confirmed the presence of mammal DNA by running a PCR using a universal mammal primer (PCR and primers will be explained below). She then shipped the DNA back to me at the University of British Columbia (UBC) packed on dry ice.
Primer design
In order to obtain a DNA sequence for a gene of interest, two molecules are designed that will find the gene along the very long DNA molecule, and help make copies of it. The molecules designed to help do this are called a primer pair. To design a primer pair, the DNA sequences are analyzed for a gene of a species of interest or related species. Molecular biologists usually use a mitochondrial gene called cytochome oxidase B (cytB) or cytochome oxidase C (cytC) for DNA barcoding in mammals. I obtained sequences for cytB from GenBank of Southern Red-backed Voles (Clethrionomys gapperi) and Townsend’s Vole (Microtus townsendii) and aligned these sequences manually using Se-Al Carbon. The aligned sequences were imported into Amplify 3X along with previously designed primers from Smith and Patton (1993). Amplify 3X is a computer program that simulates how well a primer will find and amplify a region of interest. The primers were modified to optimize amplification of cytB in C. gapperi and M. townsendii. The primer sequences are given in Table 1.
Table 1. Primers used for amplification and sequencing of cytochrome B gene of the
Lulu Island Bog small mammal
Primer Sequence (5’ to 3’)
MVZ 03A TGC CCC ATC AAA CAT CTC ATC
MVZ 16H AGG AAR TAT CAY TCT GGT TTR ATG
|
PCR
To get many copies of cytB, I mixed the primer pair with the LIB mammal DNA along with an enzyme and a combination of various chemicals. This combination was put onto a thermal-cycler to create many, many copies of the cytB gene. This process is called Polymerase Chain Reaction or PCR. The thermal-cycler profile was as follows: 35 cycles [94oC (10s), annealing at 48 oC (15s), extension at 72 oC (45s)].
Sequencing
The next step was to determine the sequence of nucleotides of the amplified cytB gene. This was done by adding just one primer to a different mixture of much more expensive chemicals and put back onto the thermal-cycler on a different profile. The final product was sent to an automated sequencer that determined the DNA sequence of what was amplified during PCR.
Blast search
This sequence was manually edited and trimmed in Se-Al Carbon, uploaded into GenBank and a blast search was conducted. The blast search compared this sequence to all sequences in a very large database to determine the most similar sequence.
Phylogenetic analysis
CytB sequences for Microtus townsendii (GenBank accession number 163906), M. canicadus (GenBank accession number 163892), M. californicus (GenBank accession number 163891.1), M. montanus (GenBank accession number 119280), M. pennsylvanicus (GenBank accession number 119279), Arvicola terrestris (GenBank accession number 275106), and Clethrionomys gapperi (GenBank accession number 309434) were downloaded from GenBank and manually aligned and trimmed using Se-Al Carbon. These aligned sequences were exported to PAUP 4.0b and a phylogenetic analysis was conducted using parsimony.
Results
PCR
After several failed attempts, the PCR reaction worked using the above thermal-cycler profile. I obtained a weak band containing about 27ng/µl of DNA (See Figure 1 for an image of the gel).
Figure 1: Ethidium bromide stained agarose gel showing faint PCR band of cytB from the Lulu Island Bog animal, Richmond, British Columbia, Canada.
Sequencing
The sequence results are shown in table 2.
Table 2. DNA sequence of a 339 base pair region of cytB obtained from a small mammal from the Lulu Island Bog, Richmond, British Columbia, Canada.
5’ACGGAATTTACTACGGCTCTTATAACATAATCGAAACATGGAACATAGGAATCATCCTACTATTCGCTGTTATAGCAACAGCATTCATAGGCTATGTACTCCCATGAGGACAAATATCATT
CTGAGGGGCCACAGTAATCACAAATCTCCTATCAGCCATCCCCTATATCGGCACAACACTAGTAGAATGAATTTGAGGGGGCTTCTCAGTAGATAAAGCTACCCTCACGCGATTCTTCGCCTTCC
ACTTCATCCTACCTTTTATTATTACCGCCCTAGTATTAGTACATCTTCTATTCCTACACGAAACAGGATCAAATAACCCAACTGGCCTAAACT3’
|
Blast search A blast search determined that the Lulu Island Bog animal was most closely related to Townsend’s Vole (Microtus townsendii). See table 3 for the first three results of the blast search.
Table 3. First three results of a GenBank blast search of a partial cytB DNA sequence obtained from a Lulu Island Bog animal, Richmond, British Columbia, Canada.
gi|6690576|gb|AF163906.1|AF163906 Microtus townsendii cytochr... 628 2e-177
gi|9695297|gb|AF163892.1|AF163892 Microtus canicaudus cytochr... 529 2e-147
gi|5478485|gb|AF119280.1|AF119280 Microtus montanus cytochrom...458 5e-126
|
Phylogenetic analysis
The LIB animal (listed as LIB in figure 2) was grouped with M. townsendii and was distantly related from non Microtus spp. See Figure 2 for the result of the phylogenetic analysis.

Figure 2. Phylogram of Microtus, Clethrionomys and Arvicola . LIB denotes the animal from the Lulu Island Bog, Richmond, British Columbia, Canada.
Conclusion
The blast search and phylogram conclusively prove that the animal in question in the Lulu Island Bog was Microtus townsendii and that it is clearly not Clethrionomys gapperi. In this case, DNA barcoding has proved useful, demonstrating that it may have a place in future small mammal surveys.
Acknowledgments
I would like to acknowledge the trapping efforts of Neil Davis, Shannon Bleasby and John MacQueen. Without their attention to detail the ambiguous animals would have been ignored. Shawn Hilton and Claudio Biancini helped with identification. Adrienne Kovach, a research Assistant Professor in the Department of Natural Resources at the University of New Hampshire volunteered to extract the DNA from the fecal pellets. I give her much thanks and recognition. Hardeep Rai, a Phd student in Sean Graham’s lab in the Department of Botany at the University of British Columbia, helped me design the primers and gave me advice on the risky PCR and sequencing.
Literature Cited
Hebert, P.D.N., M.Y. Steckle, T.S. Zemlak, and C.M. Francis. 2004. Identification of Birds through DNA Barcoding. PLOS. 2(10):1657-1663.
Smith, M.F., and J.L. Patton. 1993. The diversification of South American murid rodents: evidence from mitochondrial DNA sequence data for akodontine tribe. Biological Journal of the Linnean Society. 50:149-177. |